Stem-loop sequence bta-mir-10183

AccessionMI0032942 (change log)
DescriptionBos taurus miR-10183 stem-loop
Stem-loop
   -   -     gg        g g   --ga g     g 
5'  cug ugugg  cucgcugu g ucc    g cgggc a
    ||| |||||  |||||||| | |||    | ||||| g
3'  gac acgcc  gggcggua c ggg    c gccug c
   g   g     gg        g -   aggg g     g 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 37665525-37665598 [+]
intergenic
Database links

Mature sequence bta-miR-10183-5p

Accession MIMAT0040942
Sequence

11 - 

cucgcuguggguccgaggcggg

 - 32

Get sequence
Deep sequencing11 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).