Stem-loop sequence bta-mir-10182

AccessionMI0032941 (change log)
DescriptionBos taurus miR-10182 stem-loop
Stem-loop
   --   a -   c   g    gu       u   uc   cu  u 
5'   ggg c ccg gca uccg  cccgcgg guc  cgc  gu g
     ||| | ||| ||| ||||  ||||||| |||  |||  ||  
3'   cuc g ggc cgu aggc  gggcgcc cgg  gcg  cg a
   gu   - c   u   -    uc       -   -c   -c  u 
Get sequence
Deep sequencing
403 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 75716510-75716589 [+]
intergenic
Database links

Mature sequence bta-miR-10182-5p

Accession MIMAT0040940
Sequence

11 - 

caguccggucccgcggugucuccg

 - 34

Get sequence
Deep sequencing140 reads, 46 experiments
Evidence experimental; Illumina [1]

Mature sequence bta-miR-10182-3p

Accession MIMAT0040941
Sequence

49 - 

gcggcccgcgggcucggaugcu

 - 70

Get sequence
Deep sequencing263 reads, 52 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).