Stem-loop sequence bta-mir-10178

AccessionMI0032934 (change log)
DescriptionBos taurus miR-10178 stem-loop
Stem-loop
   acccac   accu       -c    --       ccuca g 
5'       ggu    ccuggga  cuga  ggcagca     g a
         |||    |||||||  ||||  |||||||     |  
3'       ccg    ggacccu  gacu  ucgucgu     c a
   ccacuc   accc       ua    ac       --cca a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 18014561-18014641 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-10178
bta-mir-10178chr7: 18014561-18014641 [-]
bta-mir-2455chr7: 18013236-18013311 [-]
Database links

Mature sequence bta-miR-10178-5p

Accession MIMAT0040933
Sequence

11 - 

ccuccugggaccugaggcagca

 - 32

Get sequence
Deep sequencing10 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).