Stem-loop sequence bta-mir-10177

AccessionMI0032933 (change log)
DescriptionBos taurus miR-10177 stem-loop
Stem-loop
   a  ag     a     a  --  g      -guc  - a 
5'  cc  cuccg gggcc gc  gc cugcac    gc c u
    ||  ||||| ||||| ||  || ||||||    || |  
3'  gg  ggggc cccgg cg  cg gacgug    cg g c
   g  aa     c     -  cc  g      agac  a c 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 20425027-20425101 [+]
intergenic
Database links

Mature sequence bta-miR-10177-5p

Accession MIMAT0040932
Sequence

11 - 

agggccagcgcgcugcacgucg

 - 32

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).