Stem-loop sequence bta-mir-10175

AccessionMI0032931 (change log)
DescriptionBos taurus miR-10175 stem-loop
Stem-loop
   --ac       au   g   a --a          -u   gg 
5'     ccuggau  gga aga c   gguggcuuuc  cca  c
       |||||||  ||| ||| |   ||||||||||  |||   
3'     ggaccua  ccu ucu g   ccaccgaagg  ggu  c
   cucu       cu   g   c aga          uu   aa 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 93487204-93487284 [+]
intergenic
Database links

Mature sequence bta-miR-10175-5p

Accession MIMAT0040929
Sequence

11 - 

uggagagaacagguggcuuu

 - 30

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence bta-miR-10175-3p

Accession MIMAT0040930
Sequence

49 - 

aagccaccagagcucuguccuca

 - 71

Get sequence
Deep sequencing14 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).