Stem-loop sequence bta-mir-10167

AccessionMI0032919 (change log)
DescriptionBos taurus miR-10167 stem-loop
Stem-loop
   cg        -       g uu auu   g    -   uu 
5'   gugggacu ugacccg u  c   uca uuug ggu  a
     |||||||| ||||||| |  |   ||| |||| |||   
3'   cacucugg acugggc g  g   ggu gggc cca  a
   ca        g       - gg -cu   -    g   cu 
Get sequence
Deep sequencing
384 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 27719880-27719956 [+]
intergenic
Database links

Mature sequence bta-miR-10167-3p

Accession MIMAT0040914
Sequence

47 - 

cggguggucggggcgggucag

 - 67

Get sequence
Deep sequencing384 reads, 53 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).