Stem-loop sequence bta-mir-10163

AccessionMI0032915 (change log)
DescriptionBos taurus miR-10163 stem-loop
Stem-loop
   au    a   cca      c   -    c         --ucaug   a 
5'   uuca ggc   agagag acu ugcu ugucagauu       caa g
     |||| |||   |||||| ||| |||| |||||||||       |||  
3'   gagu cug   ucucuc ugg acga acagucuga       guu a
   uc    -   uuc      u   u    -         ugacuua   c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 28894491-28894585 [-]
intergenic
Database links

Mature sequence bta-miR-10163-3p

Accession MIMAT0040910
Sequence

64 - 

ugacaagcaugguucucucucu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).