Stem-loop sequence ame-mir-3718c

AccessionMI0031790 (change log)
DescriptionApis mellifera miR-3718c stem-loop
Stem-loop
   -      g          u          cag      ----   guu 
5'  cgguuc cauuauuggg caggauaggg   ggcagg    gcc   u
    |||||| |||||||||| ||||||||||   ||||||    |||    
3'  guuaag gugauagccc guccuguccc   cuguuu    ugg   g
   g      a          u          ---      uaca   acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 6820449-6820538 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3718c
ame-mir-3718cCM000059.5: 6820449-6820538 [-]
ame-mir-3718bCM000059.5: 6820246-6820356 [+]
ame-mir-3718aCM000059.5: 6820223-6820362 [-]
Database links

Mature sequence ame-miR-3718c-5p

Accession MIMAT0037268
Sequence

11 - 

uauugggucaggauagggcag

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).