Stem-loop sequence rno-mir-351-2

AccessionMI0031766 (change log)
DescriptionRattus norvegicus miR-351-2 stem-loop
Literature search

12 open access papers mention rno-mir-351-2
(25 sentences)

Stem-loop 
   cauggcac     u     ug   a   c     g    agg ga 
5'         cucca uuccc  agg gcc uuuga ccug   u  a
           ||||| |||||  ||| ||| ||||| ||||   |   
3'         gaggu aaggg  ucc cgg gaacu ggac   a  a
   --------     c     --   g   a     -    aaa aa
Get sequence
Deep sequencing
1924089 reads, 1.21e+03 reads per million, 498 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal U residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158585587-158585667 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-351-2
rno-mir-322-2chrX: 158584542-158584636 [+]
rno-mir-503-2chrX: 158584857-158584927 [+]
rno-mir-351-2chrX: 158585587-158585667 [+]
rno-mir-542-3chrX: 158588529-158588607 [+]
rno-mir-450b-2chrX: 158589637-158589705 [+]
Database links

Mature sequence rno-miR-351-5p

Accession MIMAT0000608
Previous IDsrno-miR-351
Sequence

16 -  

ucccugaggagcccuuugagccuga

 - 40

Get sequence
Deep sequencing3846750 reads, 498 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]

Mature sequence rno-miR-351-3p

Accession MIMAT0017041
Previous IDsrno-miR-351*
Sequence

56 -  

ggucaagaggcgccugggaac

 - 76

Get sequence
Deep sequencing1412 reads, 180 experiments
Evidence experimental; SOLiD [4]

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).