Stem-loop sequence rno-mir-350-2

AccessionMI0031765 (change log)
DescriptionRattus norvegicus miR-350-2 stem-loop
Gene family MIPF0000245; mir-350
Literature search

3 open access papers mention rno-mir-350-2
(6 sentences)

Stem-loop 
   agaugccuug      c   a  -      cac u      -     gugag 
5'           cuccua aag gu aaagug   g gcuuug ggaca     g
             |||||| ||| || ||||||   | |||||| |||||     a
3'           gaggau uuc ca uuucac   c cgaaac cuugu     a
   -----guuga      -   c  c      aua c      a     aauaa
Get sequence
Deep sequencing
12002 reads, 0 reads per million, 473 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MI0000640). The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 94849816-94849914 [-]
sense
ENSRNOT00000005467 ; CEP170-201; intron 4
Database links

Mature sequence rno-miR-350

Accession MIMAT0000604
Sequence

61 -  

uucacaaagcccauacacuuucac

 - 84

Get sequence
Deep sequencing10102 reads, 435 experiments
Evidence experimental; cloned [1], SOLiD [2]

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).