![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-340-2 |
|||||
Accession | MI0031764 (change log) | ||||
Description | Rattus norvegicus miR-340-2 stem-loop | ||||
Gene family | MIPF0000191; mir-340 | ||||
Literature search |
![]()
10 open access papers mention rno-mir-340-2 | ||||
Stem-loop |
cacuu c au -caa u g ug 5' guacu ggugug uauaaag ugagac gauu ucaug u ||||| |||||| ||||||| |||||| |||| ||||| c 3' uaugg ccauac auauuuc acucug cuag ggugu g -auuc u cg auug c - uu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-340-5p |
|
Accession | MIMAT0004650 |
Sequence |
19 - uuauaaagcaaugagacugauu - 40 |
Deep sequencing | 652988 reads, 499 experiments |
Evidence | experimental; cloned [2] |
Mature sequence rno-miR-340-3p |
|
Accession | MIMAT0000585 |
Previous IDs | rno-miR-340 |
Sequence |
61 - uccgucucaguuacuuuauagcc - 83 |
Deep sequencing | 30650 reads, 460 experiments |
Evidence | experimental; cloned [1] |
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|