Stem-loop sequence rno-mir-322-2

Accession

MI0031763 (change log)

Description

Rattus norvegicus miR-322-2 stem-loop

Gene family

MIPF0000164; mir-322

Literature search

15 open access papers mention rno-mir-322-2
(100 sentences)

Stem-loop

   ccucgcuga   -       a  ca     aa             g auu 
5'          cuc cgaaggg ug  gcagc  uucauguuuugga u   g
            ||| ||||||| ||  |||||  ||||||||||||| |    
3'          ggg gcuuccc ac  cgucg  aaguacaaaacuu g   c
   ------aaa   u       c  aa     cg             g aac 

Deep sequencing

698483 reads, 431 reads per million, 503 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chrX: 158584542-158584636 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-322-2

• rno-mir-322-2: chrX: 158584542-158584636 [+]
• rno-mir-503-2: chrX: 158584857-158584927 [+]
• rno-mir-351-2: chrX: 158585587-158585667 [+]
• rno-mir-542-3: chrX: 158588529-158588607 [+]
• rno-mir-450b-2: chrX: 158589637-158589705 [+]

Database links

• EntrezGene:Mir322
• miRBase Tracker:MI0031763

Mature sequence rno-miR-322-5p

• Accession: MIMAT0001619
• Previous IDs: rno-miR-424;rno-miR-322
• Sequence: 23 - cagcagcaauucauguuuugga - 44
• Deep sequencing: 1144242 reads, 493 experiments
• Evidence: experimental; cloned [2-3], SOLiD [4]

Mature sequence rno-miR-322-3p

• Accession: MIMAT0000547
• Previous IDs: rno-miR-322;rno-miR-322*
• Sequence: 61 - aaacaugaagcgcugcaaca - 80
• Deep sequencing: 252618 reads, 498 experiments
• Evidence: experimental; cloned [1-2], SOLiD [4]

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).