Stem-loop sequence vvi-MIR171j

AccessionMI0031743 (change log)
DescriptionVitis vinifera miR171j stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

4 open access papers mention vvi-MIR171j
(14 sentences)

Stem-loop 
   --uagauac   a       a               a   u u     aa 
5'          acg gauauug uacgguucaauuaga agc g guucu  g
            ||| ||||||| ||||||||||||||| ||| | |||||   
3'          ugc cuauaac gugccgaguuaguuu uug c caaga  u
   ucuucaucc   a       c               g   u u     au
Get sequence
Deep sequencing
1144 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
NW_003725262.1: 486-585 [-]
intergenic
Database links

Mature sequence vvi-miR171j

Accession MIMAT0037305
Sequence

67 -  

ugauugagccgugccaauauc

 - 87

Get sequence
Deep sequencing1144 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).