Stem-loop sequence oar-mir-29b-2

AccessionMI0031742 (change log)
DescriptionOvis aries miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

4 open access papers mention oar-mir-29b-2
(8 sentences)

Stem-loop 
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc
Get sequence
Deep sequencing
38250 reads, 7.28e+03 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr12: 73705671-73705751 [+]
sense
ENSOART00000026311 ; oar-mir-29b-201; exon 1
Database links

Mature sequence oar-miR-29b

Accession MIMAT0030054
Sequence

52 -  

uagcaccauuugaaaucagugu

 - 73

Get sequence
Deep sequencing75914 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).