Stem-loop sequence ssc-mir-9856

AccessionMI0031634 (change log)
DescriptionSus scrofa miR-9856 stem-loop
Stem-loop
   c   u   ----u  u  a     ---a    c       u 
5'  cug gca     cc gc ucaau    gagc augcccu c
    ||| |||     || || |||||    |||| ||||||| u
3'  gac cgu     gg cg gguua    cuug uacggga u
   -   -   uuacc  u  -     gagc    -       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 69406189-69406262 [+]
intergenic
Database links

Mature sequence ssc-miR-9856-3p

Accession MIMAT0037075
Sequence

45 - 

uguuccgagauugggcuggc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).