Stem-loop sequence ssc-mir-9853-1

AccessionMI0031629 (change log)
DescriptionSus scrofa miR-9853-1 stem-loop
Gene family MIPF0002058; mir-9853
Stem-loop
   a ug  g g      --a      --  g g g  g 
5'  c  ca g cugucu   ggccgu  cg g a ug g
    |  || | ||||||   ||||||  || | | ||  
3'  g  gu u gacggg   cuggca  gc c u gc g
   c gu  g g      cga      ac  a g g  g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 57502420-57502489 [-]
sense
ENSSSCT00000023911 ; RCVRN-201; intron 2
Database links

Mature sequence ssc-miR-9853-5p

Accession MIMAT0037072
Sequence

11 - 

ugucuaggccgucggggagu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).