Stem-loop sequence ssc-mir-9847-2

AccessionMI0031623 (change log)
DescriptionSus scrofa miR-9847-2 stem-loop
Gene family MIPF0002065; mir-9847
Stem-loop
   ugcagaagau    a   c  g   -   ug     a 
5'           gccc uac ga ccc ugg  gaggc g
             |||| ||| || ||| |||  ||||| c
3'           cggg gug cu ggg acu  uucug u
   gacaaagauu    -   a  g   g   cg     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 155444859-155444933 [+]
intergenic
Database links

Mature sequence ssc-miR-9847-3p

Accession MIMAT0037066
Sequence

45 - 

ugcucagggggucaguggggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).