Stem-loop sequence ssc-mir-9845-6

AccessionMI0031619 (change log)
DescriptionSus scrofa miR-9845-6 stem-loop
Gene family MIPF0001900; mir-9845
Stem-loop
   ca  ag      aa  -   auc         uccuuu     c 
5'   cu  ggccug  cc cag   ggcccgggg      gugug a
     ||  ||||||  || |||   |||||||||      |||||  
3'   ga  ccggac  gg guc   cuggguccc      cgcac g
   ac  ca      -c  u   acu         ----cc     g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 69661596-69661679 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-9845-6
ssc-mir-9845-5chr17: 69657802-69657885 [+]
ssc-mir-9845-6chr17: 69661596-69661679 [+]
Database links

Mature sequence ssc-miR-9845-5p

Accession MIMAT0037063
Sequence

11 - 

ugaacccagaucggcccggg

 - 30

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).