Stem-loop sequence ssc-mir-9803

AccessionMI0031567 (change log)
DescriptionSus scrofa miR-9803 stem-loop
Stem-loop
   -     -     ccaa        ---   -a      c 
5'  ugugg cggcu    ggucauga   ucg  ucggca a
    ||||| |||||    ||||||||   |||  |||||| c
3'  acacu gucgg    ucagugcu   ggu  agcugu a
   a     u     ucgg        uua   ag      c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 4905709-4905783 [-]
intergenic
Database links

Mature sequence ssc-miR-9803-5p

Accession MIMAT0037021
Sequence

11 - 

ccaaggucaugaucgaucggc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).