Stem-loop sequence ssc-mir-9786-1

AccessionMI0031546 (change log)
DescriptionSus scrofa miR-9786-1 stem-loop
Gene family MIPF0002120; mir-9786
Stem-loop
   c  g   cuagg c     aa  g        guag   -gg agg 
5'  gc cau     g acccu  ga uuuaggau    aca   c   g
    || |||     | |||||  || ||||||||    |||   |    
3'  cg gua     c uggga  cu ggaucuua    ugu   g   a
   -  a   --cua -     gg  -        agaa   gaa gau 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 38596106-38596193 [+]
sense
OTTSUST00000011127 ; TSPAN7-001; intron 1
OTTSUST00000011128 ; TSPAN7-004; intron 1
OTTSUST00000011129 ; TSPAN7-003; intron 1
ENSSSCT00000033070 ; TSPAN7-001; intron 1
ENSSSCT00000033212 ; TSPAN7-004; intron 1
ENSSSCT00000036230 ; TSPAN7-003; intron 1
Database links

Mature sequence ssc-miR-9786-3p

Accession MIMAT0037003
Sequence

59 - 

agaauucuaggucggagggu

 - 78

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).