![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tae-MIR5200 |
|||||
Accession | MI0031542 (change log) | ||||
Description | Triticum aestivum miR5200 stem-loop | ||||
Gene family | MIPF0001904; MIR5200 | ||||
Literature search |
![]()
7 open access papers mention tae-MIR5200 | ||||
Stem-loop |
a u a cuag u uuc 5' acua uuaagccuuag ga uaucuaca uaagu uuuc a |||| ||||||||||| || |||||||| ||||| |||| u 3' uggu gguucggaauc cu auagaugu auucg aaag g g c c uacg u uuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was incorrectly named MIR2032 in [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence tae-miR5200 |
|
Accession | MIMAT0037000 |
Sequence |
66 - uguagauacucccuaaggcuu - 86 |
Deep sequencing | 585760 reads, 116 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:19499258
"Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv"
Funct Integr Genomics. 9:499-511(2009).
|