![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tae-MIR9653b |
|||||
Accession | MI0031538 (change log) | ||||
Description | Triticum aestivum miR9653b stem-loop | ||||
Literature search |
2 open access papers mention tae-MIR9653b | ||||
Stem-loop |
c c c ug 5' cca gg cauggccaaggucu u aggcu ||| || |||||||||||||| | |||| u 3' ggu cc guaccgguuucaga a uccgg a u - gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was incorrectly named MIR2022 in [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence tae-miR9653b |
|
Accession | MIMAT0036996 |
Sequence |
10 - uggccaaggucucuugaggcu - 30 |
Deep sequencing | 28226 reads, 116 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:19499258
"Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv"
Funct Integr Genomics. 9:499-511(2009).
|