Stem-loop sequence tae-MIR9774

AccessionMI0031527 (change log)
DescriptionTriticum aestivum miR9774 stem-loop
Literature search

2 open access papers mention tae-MIR9774
(2 sentences)

Stem-loop
                           cu 
5' aagacagaaauacccaauaucuug  a
   ||||||||||||||||||||||||   
3' uucugucuuuauggguuauagaac  g
                           aa 
Get sequence
Deep sequencing
73543 reads, 125 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was incorrectly named MIR2007 in [1].

Genome context
Coordinates Overlapping transcripts
1B: 89459479-89459532 [+]
intergenic
1B: 154254422-154254475 [-]
intergenic
4D: 97215455-97215508 [-]
intergenic
Database links

Mature sequence tae-miR9774

Accession MIMAT0036985
Sequence

31 - 

caagauauuggguauuucuguc

 - 52

Get sequence
Deep sequencing41128 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).