Stem-loop sequence oha-mir-449c

AccessionMI0031471 (change log)
DescriptionOphiophagus hannah miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---   g      u   c       cuc      a    uu  a 
5'    gug gauggu ugg aguguac   uuaguu gcug  gu c
      ||| |||||| ||| |||||||   |||||| ||||  ||  
3'    cac uuauua acc ucacaug   aaucaa cgac  ua a
   uaa   g      u   u       ---      -    cu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000175.1: 574995-575077 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-449c
oha-mir-449aAZIM01000175.1: 575592-575687 [-]
oha-mir-449cAZIM01000175.1: 574995-575077 [-]
Database links

Mature sequence oha-miR-449c-5p

Accession MIMAT0036927
Sequence

12 - 

uggcaguguaccucuuaguuagcu

 - 35

Get sequence
Evidence not experimental

Mature sequence oha-miR-449c-3p

Accession MIMAT0036928
Sequence

51 - 

gcaacuaaguacacuuccaua

 - 71

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).