Stem-loop sequence oha-mir-449a

AccessionMI0031470 (change log)
DescriptionOphiophagus hannah miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ----u        a    aa       guac          ------a   a 
5'      gugugugu gugg  uggcagu    uguuagcugg       ugg u
        |||||||| ||||  |||||||    ||||||||||       |||  
3'      uauacacg cauc  accgucg    acagucgacc       acc a
   gguuu        g    cg       acuu          acgguag   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000175.1: 575592-575687 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-449a
oha-mir-449aAZIM01000175.1: 575592-575687 [-]
oha-mir-449cAZIM01000175.1: 574995-575077 [-]
Database links

Mature sequence oha-miR-449a-5p

Accession MIMAT0036925
Sequence

17 - 

uggcaguguacuguuagcugga

 - 38

Get sequence
Evidence not experimental

Mature sequence oha-miR-449a-3p

Accession MIMAT0036926
Sequence

55 - 

accagcugacauucagcugcca

 - 76

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).