Stem-loop sequence gma-MIR9765

AccessionMI0031064 (change log)
DescriptionGlycine max miR9765 stem-loop
Stem-loop
        g         c        a              --u g     gau 
5' uccag uguuauuaa uugucuuc aauucuguauuacc   u cagcg   u
   ||||| ||||||||| |||||||| ||||||||||||||   | |||||    
3' agguc acaauaauu aacagagg uuaagacauaaugg   a gucgu   g
        a         c        c              cuu g     aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 3590200-3590303 [+]
intergenic
Database links

Mature sequence gma-miR9765

Accession MIMAT0036402
Sequence

68 - 

uaauacagaauucggagacaac

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1