Stem-loop sequence gma-MIR9761

AccessionMI0031059 (change log)
DescriptionGlycine max miR9761 stem-loop
Literature search

1 open access papers mention gma-MIR9761
(2 sentences)

Stem-loop
   -         g       a               a                         uaa              --        -   c     ------ca    -cc gu 
5'  gaguuugaa gucuagg uauuuuguaucuagg uuuucaauugauuuggcuugggacu   uugaguuuuuauuu  uguuuuug ggu agugu        ugga   c  a
    ||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||   ||||||||||||||  |||||||| ||| |||||        ||||   |  c
3'  cucaaacuu uagauuc guaaaacauagaucc aaaaguuaauuaaaccgaacccuga   aacucaaaaauaaa  acaaaaac cca ucacg        accu   g  a
   a         a       c               c                         uua              au        a   a     aacacaaa    aua aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 5714918-5715139 [-]
intergenic
Database links

Mature sequence gma-miR9761

Accession MIMAT0036397
Sequence

6 - 

ugaaggucuaggauauuuugu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1