Stem-loop sequence gma-MIR5780d

AccessionMI0031058 (change log)
DescriptionGlycine max miR5780d stem-loop
Gene family MIPF0001918; MIR5780
Stem-loop
   -                                auuauucc      c             g               c a      a               -a   c uc    auau 
5'  auuuuuguuuugaguuucugauaaauuuuucc        gaguuc ugauauauuaaaa uuuuguuuugggucu u ucguca uuaagugaugaugug  gcu u  caac    a
    ||||||||||||||||||||||||||||||||        |||||| ||||||||||||| ||||||||||||||| | |||||| |||||||||||||||  ||| |  ||||    u
3'  uaaaaacaaaacucaaagacuauuuaaaaagg        cuuaag acuauauaauuuu aaaauaaaauucaga a agcagu aauucacuacuacac  ugg a  guug    c
   c                                caacaaca      a             a               a c      c               ca   u ga    cuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 5111839-5112077 [+]
intergenic
Database links

Mature sequence gma-miR5780d

Accession MIMAT0036396
Sequence

6 - 

uguuuugaguuucugauaaauu

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1