Stem-loop sequence gma-MIR9759

AccessionMI0031056 (change log)
DescriptionGlycine max miR9759 stem-loop
Stem-loop
            ca                                                         -------                    c       -  a       a  au 
5' acuucuuuu  ucauaaaaaaauuaacuucuuccaugcauuaaauuuuacuugcuuauagaaaaaaaa       aggaaaauaauauuaauaau auuaaug au cauuaau au  u
   |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||| ||||||| || ||||||| ||  a
3' ugaagaagg  aguauuuuuuuaauugaagaagguacguaauuuaagaugaacgaauaucuuuuuuuu       ucuuuuuauuauaauuauua uaauuac ua guaauua ua  a
            -c                                                         ucucuuu                    a       a  -       c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 43981012-43981242 [+]
intergenic
Database links

Mature sequence gma-miR9759

Accession MIMAT0036394
Sequence

174 - 

uauaagcaaguagaauuuaau

 - 194

Get sequence
Evidence experimental; Illumina [1]

References

1