Stem-loop sequence gma-MIR5670b

AccessionMI0031055 (change log)
DescriptionGlycine max miR5670b stem-loop
Gene family MIPF0001978; MIR5670
Literature search

1 open access papers mention gma-MIR5670b
(3 sentences)

Stem-loop
   u    c      c              a          cau                     a             c              cuguaguuc  g 
5'  ucaa gaagca auguggugugaugu agggaaauac   gacugaauuuaguugaacccu uuaacaauauuca ugugaugcuugaca         cc u
    |||| |||||| |||||||||||||| ||||||||||   ||||||||||||||||||||| ||||||||||||| ||||||||||||||         ||  
3'  aguu cuucgu uauaccauacuaca ucccuuuaug   uugacuuaaaucaauuugggg gauuguuauaagu acacuacgaacugu         gg a
   -    a      u              c          auc                     a             -              --------a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 10713946-10714143 [-]
intergenic
Database links

Mature sequence gma-miR5670b

Accession MIMAT0036393
Sequence

172 - 

cacaucauaccauauuugcuuc

 - 193

Get sequence
Evidence experimental; Illumina [1]

References

1