Stem-loop sequence gma-MIR9758

AccessionMI0031054 (change log)
DescriptionGlycine max miR9758 stem-loop
Stem-loop
                                                 g         a     cccauacuagcauaccccaguaucgaggcaaggauacggauaaggcuacau 
5' uaagcacacccuauuuacagaucauauguuuagucaugcaaguuua uaguauacu gcgua                                                   a
   |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||                                                    
3' auucgugugggauaaaugucuaguauacaaaucaguauguucaaau aucguauga ugcau                                                   c
                                                 a         g     aacgucacaggccuucgaggagcgauucguuuccauaccuuuucccauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR9758

Accession MIMAT0036392
Sequence

27 - 

uguuuagucaugcaaguuuag

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1