Stem-loop sequence gma-MIR9756

AccessionMI0031049 (change log)
DescriptionGlycine max miR9756 stem-loop
Stem-loop
   cuaug  c                      a       a     a      uaacaaguu       a        a   -  c        -------------uu    ----uu     aaaaau 
5'      gc cuguuuggguaaaguucucaau agcacuu uagga aagaaa         aaaauga uuaagcuu ucc ca aaguuaaa               agcu      uggaa      g
        || |||||||||||||||||||||| ||||||| ||||| ||||||         ||||||| |||||||| ||| || ||||||||               ||||      |||||       
3'      cg gacaaaccuauuucaagaguua ucgugaa auuuu uucuuu         uuuuacu aauuugaa ggg gu uucaauuu               ucga      accuu      a
   -auaa  a                      c       c     c      -uaucuauc       a        -   a  a        uaaucaaauacauau    uuaaau     caaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 43318601-43318837 [+]
intergenic
Database links

Mature sequence gma-miR9756

Accession MIMAT0036387
Sequence

211 - 

ugagaacuuuauccaaacagag

 - 232

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).