Stem-loop sequence gma-MIR9755

AccessionMI0031048 (change log)
DescriptionGlycine max miR9755 stem-loop
Stem-loop
      a        -        a   a            caa   aa 
5' ggu aaaauuga ggugaaaa uuc uggaucaguuuu   ugc  c
   ||| |||||||| |||||||| ||| ||||||||||||   |||   
3' cca uuuuaacu cuacuuuu aag accuagucaaaa   acg  u
      a        u        c   g            uaa   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 23400197-23400289 [-]
intergenic
Database links

Mature sequence gma-miR9755

Accession MIMAT0036386
Sequence

61 - 

ugauccaggaacuuuucaucu

 - 81

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2