Stem-loop sequence gma-MIR9754

AccessionMI0031047 (change log)
DescriptionGlycine max miR9754 stem-loop
Stem-loop
   -u    a           a  c         u    uu           u        g     c           au     u          u  c  aac     a   ac 
5'   uucu uacuuucgguc aa guggucaag uccc  uacuuucauau gaugaauu ggucc caaacuuuaaa  acaug ggauuuaguc cc cg   ucuaa aau  g
     |||| ||||||||||| || ||||||||| ||||  ||||||||||| |||||||| ||||| |||||||||||  ||||| |||||||||| || ||   ||||| |||  a
3'   gaga augaaagucag uu caccaguuc aggg  gugaaaguaug uuacuuaa ccggg guuugaaauuu  uguac ccuaaaucag gg gu   agauu uua  u
   cu    c           a  a         c    uu           -        a     a           cu     -          -  a  -aa     c   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 1375012-1375237 [-]
intergenic
Database links

Mature sequence gma-miR9754

Accession MIMAT0036385
Sequence

198 - 

ugaccacauuagacugaaagua

 - 219

Get sequence
Evidence experimental; Illumina [1]

References

1