Stem-loop sequence gma-MIR9753

AccessionMI0031046 (change log)
DescriptionGlycine max miR9753 stem-loop
Stem-loop
                      guc a          a    aa   -       g                c a   a     a               c         auuuauu 
5' acauuuuguuuuccuucuu   g cuucuuaaag cuaa  ccc caaaacc aagcuccaaaauuagc c ucu uugua cccuaagucccaaau gugauaugu       a
   |||||||||||||||||||   | |||||||||| ||||  ||| ||||||| |||||||||||||||| | ||| ||||| ||||||||||||||| |||||||||       a
3' uguaaaacaaaaggaggaa   c gaagaauuuc gauu  ggg guuuugg uucgggguuuugguug g aga aacau gggauucaggguuua cacuauaua       u
                      aac c          g    -c   u       g                a a   c     c               a         aucuuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 38183556-38183784 [-]
intergenic
Database links

Mature sequence gma-miR9753

Accession MIMAT0036384
Sequence

131 - 

acaauuugggacuuagggcuacaa

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1