Stem-loop sequence gma-MIR9746h

AccessionMI0031035 (change log)
DescriptionGlycine max miR9746h stem-loop
Gene family MIPF0001884; MIR9746
Stem-loop
   aca   c  c                       a     c          ---guuuu     a  a                  -     c   a            u  uu               ucucagcugagaaguuauuuuuggucagauuuaaagcaacuuaacuacauaugucaccuuaaaacagaacaguacucaucuauugcuauuacuauugcggugcaacaaa 
5'    guu uc aauugagauucaagcacuuuucu ugugg uuuaaggugu        auugc ug gcaagauguugaaugcag ggauu aua aacaaauuguca ac  uugcaugccuuaagu                                                                                                             u
      ||| || ||||||||||||||||||||||| ||||| ||||||||||        ||||| || |||||||||||||||||| ||||| ||| |||||||||||| ||  |||||||||||||||                                                                                                             u
3'    caa ag uuaacucuaaguuugugaaaaga guacc aaauuccaca        uaacg au cguuuuacaacuuacguu cuuaa uau uuguuuaacagu ug  aacguacggaauucg                                                                                                             u
   -ac   u  a                       a     u          agguacgu     a  c                  a     u   c            u  uu               auuugauaaaaaccaaccuaagcuuuguugaauuggugaauauaacgaaguuuuaucuucucaugaguuuaugauauguguuguucaaauuacaguaagaagauuguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 11768911-11769382 [-]
intergenic
Database links

Mature sequence gma-miR9746h

Accession MIMAT0036373
Sequence

444 - 

aaaguguuugaaucucaauuagau

 - 467

Get sequence
Evidence experimental; Illumina [1]

References

1