Stem-loop sequence gma-MIR9744

AccessionMI0031026 (change log)
DescriptionGlycine max miR9744 stem-loop
Stem-loop
   -      a               u   ggaca        g   g      ug   uu   uucu  --ua  a     -    u       aucauuccccauguauacacuuucaga 
5'  gaacua uggauaugagcugca aca     gaauggcu uga gggugc  gau  guu    gc    ug agccu ccau ggcuaag                           c
    |||||| ||||||||||||||| |||     |||||||| ||| ||||||  |||  |||    ||    || ||||| |||| |||||||                           u
3'  cuugau accuauacucgacgu ugu     cuuauuga acu cccacg  cua  caa    ug    ac ucgga ggua ccgauuc                           u
   u      a               c   aguca        g   a      gu   uc   --uu  ucac  c     a    -       aaucuuacccucucuucgagagucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 53225973-53226206 [+]
intergenic
Database links

Mature sequence gma-miR9744

Accession MIMAT0036364
Sequence

6 - 

aauggauaugagcugcauaca

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1