Stem-loop sequence gma-MIR9740

AccessionMI0031022 (change log)
DescriptionGlycine max miR9740 stem-loop
Stem-loop
   -auc     a   u              c            ccauaaacaaugaaagaagcuugguaugagag 
5'     uaugu ggu ccagugagggaaau aaagugaagggu                                a
       ||||| ||| |||||||||||||| ||||||||||||                                g
3'     auaca cca ggucacuuccuuua uuucacuuccca                                u
   auaa     c   c              c            ucuuuacuaagcaugauuguggugagaacggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 4672076-4672223 [+]
intergenic
Database links

Mature sequence gma-miR9740

Accession MIMAT0036360
Sequence

6 - 

uguagguuccagugagggaaa

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1