Stem-loop sequence gma-MIR9739

AccessionMI0031021 (change log)
DescriptionGlycine max miR9739 stem-loop
Stem-loop
   auaa     ua                       cuuaugc       acuu 
5'     gagug  uaucuggacauuuaaaugguaau       cgagaga    u
       |||||  |||||||||||||||||||||||       |||||||    u
3'     cucau  auagaccuguaaguuuaccauug       guuuucu    c
   -agg     gc                       uaaauua       acga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 36092901-36093006 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9739
gma-MIR9739chr16: 36092901-36093006 [+]
gma-MIR4994chr16: 36093877-36093967 [+]
Database links

Mature sequence gma-miR9739

Accession MIMAT0036359
Sequence

81 - 

uuugaauguccagauacguac

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1