Stem-loop sequence gma-MIR9738

AccessionMI0031020 (change log)
DescriptionGlycine max miR9738 stem-loop
Stem-loop
   g g                                  agacaucuaagaaggucauucagauguuguugaagacauauacaguuag 
5'  c auggaagaguucaugucguguuucagaaugauuc                                                 a
    | ||||||||||||||||||||||||||||||||||                                                  
3'  g uaccuucucagguguaguacaaagucuuacuaag                                                 a
   - g                                  gucauaguaacuucuuuaucugccaauaccguguuuuacucucccagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 32364380-32364552 [+]
intergenic
Database links

Mature sequence gma-miR9738

Accession MIMAT0036358
Sequence

147 - 

ugaaacaugauguggacucuuc

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1