Stem-loop sequence gma-MIR9737

AccessionMI0031019 (change log)
DescriptionGlycine max miR9737 stem-loop
Stem-loop
   -         g          cu  u    a  c       uaaccuugaggguau 
5'  ugacguugu gcugaaauca  gu gcag cc uuuuuua               a
    ||||||||| ||||||||||  || |||| || |||||||                
3'  acuguaacg cgacuuuagu  ca cguc gg aaaagau               a
   a         a          au  u    c  u       uuuaauacuacugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 14848422-14848534 [+]
intergenic
Database links

Mature sequence gma-miR9737

Accession MIMAT0036357
Sequence

6 - 

uuguggcugaaaucacuguugc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1