Stem-loop sequence gma-MIR9736

AccessionMI0031018 (change log)
DescriptionGlycine max miR9736 stem-loop
Stem-loop
   aag  c             a         cc   u         --------------------    u 
5'    gu cccaccuuuguuu ucuuucauc  uca uauccucaa                    guug c
      || ||||||||||||| |||||||||  ||| |||||||||                    ||||  
3'    ca ggguggaaacaaa agaaaguag  ggu auaggaguu                    uaac c
   -aa  a             c         ua   u         uucccacuuucuauucguac    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 46142093-46142211 [+]
intergenic
Database links

Mature sequence gma-miR9736

Accession MIMAT0036356
Sequence

94 - 

ugaaagacaaacaaagguggg

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1