Stem-loop sequence gma-MIR9734

AccessionMI0031016 (change log)
DescriptionGlycine max miR9734 stem-loop
Stem-loop
   -aa   u       a  ga   a           c      -  c                              a       uauuuu       --  g 
5'    ggg guguagu ga  aau ucauagaaagu aacuau cu uauaaauuaagcaacacaaauuucauucac augggua      uguuauu  ag u
      ||| ||||||| ||  ||| ||||||||||| |||||| || |||||||||||||||||||||||||||||| |||||||      |||||||  ||  
3'    ccc cacauca cu  uua aguaucuuuua uugaua ga auauuuaauucguuguguuuagaguaagug uacucgu      acaauga  uc g
   ucc   -       c  uc   a           a      a  -                              c       ------       au  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 48700793-48700984 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR9734
gma-MIR9734chr14: 48700793-48700984 [-]
gma-MIR4345chr14: 48700139-48700232 [-]
Database links

Mature sequence gma-miR9734

Accession MIMAT0036354
Sequence

118 - 

ucgugaaugagauuuguguugcuu

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1