Stem-loop sequence gma-MIR9733

AccessionMI0031015 (change log)
DescriptionGlycine max miR9733 stem-loop
Stem-loop
        cc                     g          u    c               gaagcuaacaaagugucaca 
5' cauuu  aaacuuuugcuuuugguaccu cuguuagucu gguc guuaagugaugaugu                    u
   |||||  ||||||||||||||||||||| |||||||||| |||| |||||||||||||||                     
3' guaaa  uuugaaaacgaaaaccaugga gacaauuaga ucag caauucacuacugca                    c
        aa                     a          u    a               ggguuguagugaauugguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 47539902-47540063 [-]
intergenic
Database links

Mature sequence gma-miR9733

Accession MIMAT0036353
Sequence

114 - 

uaacagacuuagauuaacaga

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1