Stem-loop sequence gma-MIR5780c

AccessionMI0031014 (change log)
DescriptionGlycine max miR5780c stem-loop
Gene family MIPF0001918; MIR5780
Stem-loop
   u       ug       a                    u   cc   accgcca   a       aca  a      uc    ga  gauaua 
5'  guuguuc  agucucu auauauuaaaaguuuuguuu ggg  ccu       auu agugaug   ug caucau  caau  cu      u
    |||||||  ||||||| |||||||||||||||||||| |||  |||       ||| |||||||   || ||||||  ||||  ||      a
3'  uaacaag  ucaggga uauauaauuuucaaaacaaa ccc  gga       uaa ucacuac   ac guggua  guug  ga      u
   -       gu       c                    -   ua   acaguag   a       cac  c      ga    uc  gaaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 16753071-16753257 [-]
intergenic
Database links

Mature sequence gma-miR5780c

Accession MIMAT0036352
Sequence

161 - 

uuuaauauaucagggacuugga

 - 182

Get sequence
Evidence experimental; Illumina [1]

References

1