Stem-loop sequence gma-MIR9732

AccessionMI0031013 (change log)
DescriptionGlycine max miR9732 stem-loop
Stem-loop
   u               ca             ----    -    a       cc 
5'  ucuugagauugcaca  auaucuuugccuu    acuu uaca uaucucu  u
    |||||||||||||||  |||||||||||||    |||| |||| |||||||   
3'  agaauucuaacgugu  uaugggaacggaa    uggg augu auggggg  u
   -               ag             aaau    c    c       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 22614328-22614431 [-]
intergenic
Database links

Mature sequence gma-miR9732

Accession MIMAT0036351
Sequence

79 - 

caaggguaugaugugcaaucu

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1