Stem-loop sequence gma-MIR9731

AccessionMI0031012 (change log)
DescriptionGlycine max miR9731 stem-loop
Stem-loop
   -     a          g     aa  c       ucaaaaca  g  c 
5'  ucugc uacauaucgu uugcc  gc gucucca        gg ac a
    ||||| |||||||||| |||||  || |||||||        || || a
3'  agacg auguauagca gacgg  cg cagaggu        cc ug g
   u     c          a     aa  a       --------  g  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 42798110-42798201 [+]
intergenic
Database links

Mature sequence gma-miR9731

Accession MIMAT0036350
Sequence

6 - 

auacauaucguguugccaagc

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1