Stem-loop sequence gma-MIR9730

AccessionMI0031011 (change log)
DescriptionGlycine max miR9730 stem-loop
Stem-loop
   a g                  a              ug             acu      gc    g   uag  uc  u   ug          a      gaaaaauug     gc 
5'  g cuugcagcaguuaugaca caauugugggguuu  uguugcaaucaug   auuuaa  uuuu gcu   gu  ca uuu  cucuugguuc aaggug         guuuu  c
    | |||||||||||||||||| ||||||||||||||  |||||||||||||   ||||||  |||| |||   ||  || |||  |||||||||| ||||||         |||||  c
3'  c gaacgucgucaauacugu guuagcacccuaaa  guaacguuaguac   uaaauu  aaaa cgg   ca  gu aaa  ggggaccaag uuccac         uaaaa  a
   - g                  c              gu             guu      aa    a   cua  ca  u   gu          g      auuuauuug     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 37550244-37550481 [-]
intergenic
Database links

Mature sequence gma-miR9730

Accession MIMAT0036349
Sequence

212 - 

cgauugcugucauaacugcugc

 - 233

Get sequence
Evidence experimental; Illumina [1]

References

1