Stem-loop sequence gma-MIR9729

AccessionMI0031009 (change log)
DescriptionGlycine max miR9729 stem-loop
Stem-loop
   -u  a                     g       ----- gg   c    u    au   a  uc g 
5'   uc aguaaugaguagaaacauuua aagaguu     c  uua gcaa aaua  gau uc  u a
     || ||||||||||||||||||||| |||||||     |  ||| |||| ||||  ||| ||  |  
3'   gg uuauuacucauuuuuguaaau uuuuuaa     g  agu cguu uuau  uua ag  g a
   cu  a                     g       uuuau aa   u    -    gu   -  uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 30067721-30067848 [-]
intergenic
Database links

Mature sequence gma-miR9729

Accession MIMAT0036347
Sequence

6 - 

guaaugaguagaaacauuuagaag

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1