Stem-loop sequence gma-MIR9723

AccessionMI0031000 (change log)
DescriptionGlycine max miR9723 stem-loop
Stem-loop
           c                 a       a            c   u   c  auuuaaca     cc   -    uuuuaaucu 
5' ggaauucc uggcaaauucccaaagg gauuugg caacucauuuuu caa aaa gc        ucuaa  acc caaa         u
   |||||||| ||||||||||||||||| ||||||| |||||||||||| ||| ||| ||        |||||  ||| ||||          
3' ccuuaagg accguuuaaggguuucc cuaaacc guugaguaaaaa guu uuu cg        agauu  ugg guuu         a
           a                 c       a            a   u   a  -------g     ca   a    uuauccuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 3072531-3072704 [-]
intergenic
Database links

Mature sequence gma-miR9723

Accession MIMAT0036338
Sequence

21 - 

caaaggagauuuggacaacuc

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1